Fumbani Chibaka

Free Bawo Game App release Delayed

2010-08-07T18:23:00.000-07:00

It was originally announced on bawogame.com that Fumba Game Lab™ (FGL™) will launch the free downloadable bawo app on the 8^th of August, but due to a technical malfunction FGL™ will be releasing this traditional African bawo game application a couple of days after its originally scheduled release date.

With help and advice from game testers and professional programmers, FGL™ is optimizing its bawo app which will be playable on both Windows and Mac OS X platforms. This announcement comes after active bugs had been identified in the application which FGL™ had packaged for distribution. The application will be optimized promptly rather than being deployed in its current state at the expense of quality.

Free Bawo / Bao / Omweso African Mancala Game on www.bawogame.com

2010-07-25T11:50:00.000-07:00

Fumba Game Labs™ will be officially releasing its first version of the traditional African mancala game on the 8th of August, 2010. Bawo ( Bao, Omweso ) is played is several countries of Eastern Africa (including Tanzania, Kenya, Malawi and eastern Congo) but it is most popular among Swahili people of Tanzania and Kenya. [ref: Wiki].

Fumba Game Labs™ Bawo Version 1 will be available for free download at www.bawogame.com . The bawo game will be compatible with all Windows Operating Systems (XP, Vista and 7), Macintosh OS and Mobile Devices that support Adobe Flash Player. The game will also be playable on Apple iPhone and iPad.

The first version of FGL™ Bawo Game will be available as a standalone application which will not require any installation. It will also be playable online from any browser with the Adobe Flash player plugin.

Fumba Chibaka
Game Designer, Fumba Game Labs™.

.

...more energy evading work. more of creative excuses.

2010-07-08T08:34:00.000-07:00

A strip from Calvin and Hobbes- one of my favorite comics. Fumba- July 08, 2010

How to pause Code Execution in Adobe Flash Actionscript3 (as3)

2010-06-24T12:03:00.000-07:00

I wish as3 had a method .pause() to perform this function. Unfortunately it doesnt so this is how I achieved pausing during code execution. Any clever ideas- anyone?

In the .as file package,

import flash.utils.Timer;
import flash.events.TimerEvent;

//create a timer instance that shoots every 0.1 sec (100ms) - infinity

// in this case, code execution will pause up until the value of playBoolean == true

var pauseTimer:Timer = new Timer(100, 0);

//add a listener for the timer (executes the function "startAction" once frame is loaded)
pauseTimer.addEventListener(TimerEvent.TIMER, startAction);

function startAction(evt:Event){
        if (playBoolean == true){
                      //put code that needs to be delayed here
                       pauseTimer.stop();

                }
          }

Fumba out,

HIV Drug Resistance Research: KaKs Calculation Tool 1.0

2010-04-04T11:49:00.000-07:00

It's a beautiful sunny Easter day in the historical town of Gettysburg. Days like these admittedly make any Malawian in Diaspora reminisce eating raw sugarcanes with fellow mboba [acquaintances]. Despite the elevated homesickness levels, I stumbled upon and immersed myself in a genomics article by Lamei Chen and Christopher Lee from the Department of Chemistry and Biochemistry at the UCLA, Los Angeles.

Related Fact:

HIV mutates within weeks of new drug discovery. However, the detection of mutation requires a combination of lengthy clinical research, some molecular biology (eg.DNA sequencing) and biochemistry(eg. obtaining viral samples).

Chen and Lee carried out a research that established a faster, probably cost-effective way of identifying relevant drug resistance mutations in HIV-I. The team distinguished HIV-I drug resistance by studying mutations using computational analysis tools to measure evolutionary selection pressure inorder to detect primary mutations versus accessory ones. Viral fitness versus drug resistance mutations.

So, Whats the ~~fuss all about~~ deal?

For my bionformatics term project, I implemented and developed a web-based naive version of the KaKs Calculator 1.0, a primary tool that Chen and Lee used in their research. By using KaKs values, the team compared trends between treated and untreated (HIV) datasets. Their study concluded that KaKs analysis could be an effective way of distinguishing drug-resistance that associated with mutations from viral fitness mutations. According to their research, this could be a helpful way to understand the roles of different mutations in the development of drug resistance.

I love it when computer science and Biology become incompatible. Go bioinformatics! Click on the Technocentrics logo to go to my web-based KaKs Calculation Tool.

Reference:

Chen L, Lee C: Distinguishing HIV-1 drug resistance, accessory, and viral fitness mutations using conditional selection pressure analysis of treated versus untreated patient samples. Biol Direct 2006, 1:14.

Fumbani Chibaka

DFA Minimisation Java Implementation

2010-02-24T16:28:00.000-08:00

Definite Finite Automaton Minimisation- Algorithm implemented on Java. ' had loads of fun writing this code!!!

Click here to open [adobe pdf version] of the .java code.

Ps. Help- am so freaking Homesick+++!!!

Adobe Flash™/ ActionScript 3.0 [BAWO Project- Stage 0]

2009-11-20T20:07:00.000-08:00

(Use Mouse to move Hand,drag Seed to Hole with Red Circle) © Fumba 2009

Bawo is a traditional african game that is as complex as chess or checkers. I decided to develop a realistic FLASH™ version of this game for my computer science independent research topic. At first I was planning to tweak an already existing Java version of the game from sourceForge but I later decided to work on this project from scratch.

Anyways, I realized that FLASH (.swf) are programmed in a program called ActionScript 3 (as3). Stage ZERO of my project was therefore to teach myself some of the basics of this object-oriented language (which isnt that different from Java). I ended up creating a sketch version of the BAWO board with some seeds and holes on it.

Help needed

1. I have been trying to make the program recognise when a user drags a seed and drops it in hole (both seed and red hole are as3 movieclip symbols). I was not able to understand how the as3 methods hittest and getChildByName function. The application keeps giving the message "try again" because the hole does not recognise that the seed has been dropped in it.

2. I also dismally failed to change the cursor into the players hand. In this application, the seed keeps appears on top of the players hand. I had to adjust the hands alpha value (transparency) inorder to make it look more normal.

I will be more than happy to send the .fla file for the attached s application to anyone who is willing to help.

Fumbani Chibaka 2009 ~pumbafumba@aol.com

Bawo Gaming [ an adventure in Java™ and Adobe Flash™ ]

2009-11-12T12:32:00.000-08:00

Bawo is a board game popular in Malawi and most african countries. In Uganda, this game is dubbed Omweso. Walking the streets of Malawian outskirts, you would probably chance a group of people in bawo gameplay as much you would if you went down into an American kids' basement in hunt for a Nintendo Wii, Gameboy, XBox or a Playstation console.

Zanga Chimombo (who used to be my brothers work mate at Nico Technologies Ltd) successfully programmed a version of it in Java downloadable from bawo.sourceforge.net. I decided to start tweaking this SourceForge Bawo Project. I think that the Bawo version that Zanga developed is fantastic but I wish the interface and other features were improved to make the gameplay more enjoyable.

Among many things, I intend to:

1- Use Adobe Flash to come up with a more realistic bawo board

2- Animate the players hand movements

3- Add sound to the gameplay
4- Look into the possibility of creating a web-based multi-player version of the game.

I will be undertaking this project with help from my genius brother and computer science professors (Gettysburg College CS Department) . With the increasing use of technology in Malawi and other African countries, I think it is high time we started utilizing the tech-space to share our traditional games to the world.

Papers & Presentations

2009-08-25T19:18:00.000-07:00

The end of the beginning....

Fumbani Chibaka¹, Summer Intern 2009, Research Center for Genetic Medicine, Children’s National Medical Center, Washington DC 20010, USA.
¹Junior Student, BSc Biochemistry and Molecular Biology, BA Computer Science, Gettysburg College, 300 N Washington St, PA 17325, USA

Diagnosis of Unknown Muscular Dystrophy Forms: m-RNA Expression Profiling and Gene Sequencing
© 25 August 2009

Abstract
A high dimensional data clustering approach was used to investigate for gene mutations that were hypothesized to contribute to the formation of unknown forms of muscular dystrophy. This study presents comparative expression analysis of 56,000 gene probes represented on the Affymetrix HG-133 Plus 2.0 set. Individual expression profiles were generated for biopsies from a list of 12 known disease groups. mRNA profiling of muscle biopsies of 11 disease groups showed that 3 of the unknown dystrophy forms shared closely related patterns with those of CAPN3 gene. It was believed that a mutation in CAPN3 contributes to the formation of this disease form. 16 patients were studied through sequencing of the gene, but at this time, no single nucleotide polymorphism (SNP) has been observed. Detection of the SNP may facilitate in the process of understanding the pathogenesis of this form of dystrophy.

Keywords
Expression oligonucleotide microarrays, Data Clustering, Muscular Dystrophy

DNA Sequencing II (ABI Prism 310 Genetic Analyzer)

2009-08-20T10:11:00.000-07:00

The last kick of a dying horse. At the moment, I’m racing against time to collect nucleotide sequence data for my internship project. This data will make possible further research in the detection of a mutation (most probably a SNP) that leads to some unknown type of muscular dystrophy that was discovered at the Children’s Hospital Research Institute in DC.

I’m kinda finding it a bit frustrating because the process of preparing extracted patient DNA for data collection has step reactions that take hours of wait time in-between them. [I’m actually blogging now because I have to wait for 90 minutes for a PCR run to complete.]

After the Micro-array Scanner encounter, my next fascination is the Applied Biosystems (ABI) Prism 310 Sequencing machine which I am using to sequence the DNA from biopsies with the unknown type of muscular dystrophy.
[See related post- DNA Sequencing I ]
This state-of-art machine replaces the traditional gel electrophoresis with capillary electrophoresis. Equipped with high performance computer technology, the device is capable of reading and storing the data and result with low percentage errors.

Polymerase Chain Reaction (PCR)

The key to DNA sequencing is the PCR. The DNA that is extracted from patient muscle tissue has to be amplified – making it available in large amounts. Dystrophin, the gene that I am investigating in my project, is actually one of the longest (if not the longest) gene in the human genome. I am therefore using primers (both forward and reverse) to amplify only exons of interest in the DNA. 30 Primers were designed for this gene. Up to date, I have only sequenced exons using only 3 primers.

After running the PCR on the Thermocycler, the amplified DNA segments are run through a gel electrophoresis reaction. Using a ladder key, a specific band is expected at a position that corresponds to the primer that was used. The specific number of base pairs is known since we designed the primers in the lab.
In this case, I used a primer that was designed to amplify an exon sequence of about 200 bp. Electrophoresis of the PCR product produced the following result [<-].

This result show that the PCR amplification of the particular exon was a success since the band is corresponds to the 200-300 bp bands in the ladder. I was instructed to commence to the next steps only after the confirming that the used primer worked. You just gotta love PCR and Gels!

ABI prism 310 Genetic Analyzer
The DNA undergoes a couple of protocols in order to prepare it for the sequencer. The steps include the Exonuclease, Sequencing, Ethanol/Sodium Acetate Precipitation and the Denaturation reactions.

The Analyser has a laser which causes the applied dye on the four nucleotides (A-T-C-G) to illuminate different colors of the visible light spectrum. The colors are then recorded and sent to the computer for further analysis.

Sequencher® 4.9 is then used to align the output sequences (both reverse and forward) with their corresponding exon and primer sequences to make contigs.

This software has a chromatogram feature that allows for analysis of the quality of the output nucleotide sequences and detection of errors in the contig sequences. (see Real patient data below).

Click images to view them in larger version

Sadly, this is probably the last technique that I will be learning from the CRI laboratories for this summer. LG (Life‘s Good).

Calculating RNA Expression Fold Change Values (Another MATLAB® application)

2009-08-17T13:51:00.000-07:00

After a hectic weekend, it was a little bit relieving to get into the Geek-mode on a monday morning [instead of going into the in-vitro mode]. At least, programming is less frustrating than wet lab tasks which always have strange terms in the protocols. [Wet labs have actually coerced me to become best friends with Wikipedia!]

Anyways, today I ended up writing another simple function in Matlab®. This function calculates the fold change values from mRNA expression data collected from the Microarray scanner. Fold change values show if there is a significant difference between the diseased [dystrophy] muscle and the normal muscle. Together with the t-test, this statistical calculation is used to filter genes of interest from the massive collection of genes investigated using the microarray probes.

Fold change values are calculated by dividing the diseased group values by the control (normal muscle) values. If the result is less than one, its reciprocal is listed. (e.g. 0.5 or a drop of 50% from the normal expression value is reported as 2 fold down or -2 fold change).

For my project, a change will be considered significant if it is >1.7 fold up (or down). Running this function on my data eliminates ~55,000 insignificant genes and filters out ~1,000 genes of interest. Further analysis on the data will include establishing of related networks within the selected using an online based Java® deploy called IPA (Integrated Pathway Analysis) .

% Fumba Chibaka (CNMC Internship- Muscular Dystrophy DIAGNOSIS)
% August 17th, 2009
% foldChange (EXPRESSION RATIO)
% This function Calculates the fold change expression
%parameters: filteredValues(Matrix with mean Expression values/ disease group
% approx dimension (60,000 rows X 100 cols)
% : class_name (Cell array xontaining disease names)

function fold_change = foldChange(class_name, filteredVals)
r= size(filteredVals);

% number of rows in meanValues matrix
rows= r(1,1);
% num of cols in meanValues matrix
cols= r(1,2);
fold= zeros(rows-1,cols-1); % Preallocation output matrix
%Find control group Column index
for i=1: cols-1
____if ( strcmp(class_name(i),'CTRL')== 1)pos= i;
_______%temp save CTRL values in Ctrlbuffer matrix
_______Ctrlbuffer= filteredVals(:,pos:pos);
_______%delete CTRL values from data matrix
_______filteredVals(:,pos:pos)=[];
_______class_name(i)=[];
____end;
end;

%Calculate Fold Values for disease groups
%x= measured y= control
for i=1:cols-1
____for j=1:rows
_______x= filteredVals(j,i);
_______y= Ctrlbuffer(j,1); % deleted ctrl sample
_______fold_change= x/y;
_______if (fold_change<1)
__________fold_change= -1/fold_change;
_______end;
_______fold(j,i)= fold_change;
____end;
end;

class_nameFOLD= class_name;
%Save variables in a new MAT file (foldChange.mat) for further analysis
save('foldChange.mat','fold','class_nameFOLD');

DNA Sequencing

2009-08-11T16:40:00.000-07:00

I was dead wrong thinking that I was done with the in-silico part of my project. After using high dimensional computational analysis [Visda®] to perform a hierarchical clustering on the data that was collected from the micro-array scanner, it was shown that 3 out of the 8 unknown muscular dystrophy types that I am investigating are very closely related to the expression patterns of that were exhibited by the dystrophin gene-deficient samples.

Biomedical research is unpredictableSo, this observation totally changes the path that I will be taking for the next 3 weeks. I will spend the few remaining days inquiring the DNA sequence variation between the unknown muscle dystrophy and dystophin. According to my understanding, the clustering results show a high probability that the dystrophin gene mutation could be a result of a snip [ SNP (Single Nucleotide Polymorphism)]. Only 3 days of computational analysis, and am sent back to the wet lab- I really thought that I was going to spend the remaining time on the computer in my cubicle!

DNA sequencing

Before sequencing the DNA extracted from patients, my supervisor recommended that I practice this technique by using kbDNA which is already established to contain a mutation in the calpain gene on Chromosome 15. In this case, my control was DNA that contained a non-mutated calpain gene. Just like the dystropin gene, mutations in the calpain gene are associated with the muscular dystrophy disease.

In our lab we use the ABI Prism 3100® Genetic Analyser to run the sequencing. The machine and its associated peripherals are a pure product of biomedical engineering. A genius piece of technology. Inorder to prepare the DNA for sequencing, it had to go through an Exonuclease Reaction, Ethanol/Sodium Acetate Precipitation Reaction and a Denaturation reaction. The reactions mostly involved use of a PPT-225 Peltier Thermal Cycler® to do programmed PCR (Polymerase Chain Reactions) on the DNA.

The deal

I was successful in collecting the DNA sequences for both the kb-DNA and the Control-DNA using forward and reverse primers. Tomorrow, one of the graduate school interns will be teach me how to use some fancy computer software to detect the SNP from the DNA sequencing results. Out of curiosity, I downloaded ChromasPro® and used it to check out my data. ChromasPro® allowed me to view the nucleotide composition of the collected data. [This whole process was overwhelmingly exciting for me : 'amazing how I started with diseased muscle tissue ---> and ended up with letters ATCG representing significant genetic information !!!].

Real data ( ctrlDNA Forward Primer)

>e2CTRLF
ACCCTGGCGCGATGTGATCCGTCTCAAAAATACCTATCTATCTATCTGTCTATCTACTGTTAT
TCTTACCTGGTCATTTCCTTTTTGTTTCACAGGAAATTTGCGAGAATCCCCGATTTATCATTG
ATGGAGCCAACAGAACTGACATCTGTCAAGGAGAGCTAGGTAGGAAAGTGCCTCAGGTCAGA
ATTCCAGGGAGGAGGAGGAGGAGGGTATTTTTTTGAGACGGGTTTTCCTCTGTTGCGGGCG
GAATGGTGCAGGTGCCATATTGGAATCATGACAAAAAAGTCCCCAATAGAAGGGATGTTTTT
TTCTTTTGCTGGGTTGACTTTTTGAAACGACTTCCGGAGGGTCCCCCCAGGCAAAAGGGGAA
TTTTGGAACCTTGTCTCTTCCAAGAC

After using some skills that I learned from the bionformatics class that I took with Dr Steve James , I [Blasted] the sequence on the NCIB website and got the following result.

Full Detail Link: http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=nucleotide&dopt=GenBank&RID=842EP8FE01N&log%24=nucltop&blast_rank=1&list_uids=208022635

NCBI Reference Sequence: NG_008660.1
Homo sapiens calpain 3, (p94) (CAPN3) on chromosome 15

LOCUS NG_008660 74191 bp DNA linear PRI 11-AUG-2009
DEFINITION Homo sapiens calpain 3, (p94) (CAPN3) on chromosome 15.
ACCESSION NG_008660 VERSION NG_008660.1 GI:208022635
SOURCE Homo sapiens (human) ORGANISM Homo sapiens
Summary: Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq].

Looking at the BLAST description I am confident that my sequencing reaction was done correctly since the results confirm that the sequence belongs to Human Sapiens Chromosome 15 Calpain gene. Nevertheless, tomorrow the professionals will determine if I am ready to do the sequencing for the unknown muscle dystrophy and dystrophin. [Am crossing my fingers and hoping for the best].

My Cherished Cubicle

2009-08-10T16:05:00.000-07:00

With less than three weeks of interning left, I cannot shrug off retrospecting the fave moments that I have had at the Childrens Hospital . After spending a weekend in Pennsylvania where I had to move my stuff to fall housing [Quarry Suites!], I reckon it is irrevocable that going back to school will cause me to suffer from a lack of my fellow interns, my [very nice] supervisor, the brilliant glassy hospital building, the little kids in the colorful lounge, and the peculiar clown doctors [apparently, they do the Patch Adams thing at this Hospital.' wonderful.]. Above all, I will sincerely miss my work space- the most cherished cubicle. Gosh, being given my own space in the laboratories made me feel so freaking special ; a part of the research team.

Technically, the workspace belongs to the director of the Genetic Medicine Research Center [Dr. Hoffman] who happens to be an alumni of my college. He has officially become my role-model when it comes to representing Orange&Blue (my school colors) in the world of biomedical research. It has been a pleasure using his workspace for the past 8 weeks.

[left] Amazing View of DC from my cubicle (on the 5th Floor). Perfect location for Daydreaming...[right] The US Capitol building (white dome thingy). A view from my window [/wall?].

[Left] my Work Bench placie... [right] Part of the genetic medicine research lab

Click on images to view them in larger version
I usually work on me cubicle whenever my project requires some Computer Science work to be done. [For the wet labs, I did all the work at the bench that I was assigned.] The cubicle is equipped with a Dell Core 2 Duo desktop machine which makes a perfect spot for Geek-ism. Setting aside academia, my cubicle has also been the the gossip base for the Thomas Jefferson high school interns who frequently visited me as they gave their fresh brains a break from arduous data mining tasks. (of course!! I will miss 'em coffee breaks too!!)

I have spent 9 precious weeks working in this cubicle and I do not want to go back to the g'burg world where I currently belong. Nevertheless, I still have a couple of days to enjoy this nerdy- utopia. Life is Good!

Genious MIT Broad Institute GenePattern [.gct file format]

2009-08-03T16:10:00.000-07:00

Hahaha... I just got rescued by a group of benevolent MIT nerds! After hours and hours of intensive internet searching, I finally found a free tool that will help me analyse the muscular dystrophy microarray data. The tool that I chanced upon is called GenePattern3.2. It is a powerful genomic analysis platform that provides access to more than 100 tools for gene expression analysis, proteomics, SNP analysis and common data processing tasks. The MIT team developed this tool under the Broad Institute. I salute these generous guys for coming up with this top-notch insilico research software.

[Changing data from matlab (.mat) format to GenePattern3.2 (.gct) format]

I spent a good chunk of the afternoon planning out the steps that I will follow inorder to carry out gene expression profiling of the unknown type of muscular dystrophy. Gosh... 'stuff is kinda crazy confusing! However, I got some bonus time at the end of the day and ended up having some fun programming in the MATLAB® language. Apparently the GenePattern3.2 gene clustering module only accepts a specific file format (.gct) [see excel image below]. I had to use my inadequate Matlab skills to write a script that would convert all the .mat massive matrix data files into the GenePattern format. The task was a success [even though I surerly know that my computer science professor would give it a B- grade!]I had four .mat data files and each took ~5mins to convert into a .gct file with only raw ASCII format text that occupied ~32MB of space . Massive data!!

% Fumba Chibaka (CNMC Internship- MD DIAGNOSIS)
% August 3rd, 2009
% Converts MATLAB (.mat) matrix data to raw GENE PATTERN (.gct) textformat
% Data collected from Human Genome U133 Plus 2.0 Array
% expressnValues = matrix (~60,000 rows/ 200 cols)-gene expression values
% probeid = cell array (~60,000 elements) - microarray probe gene id
% class_name = cell array (~10 elements) - disease groups
function output= genePattern(expressnValues, probeid, class_name)
M= size(expressnValues);
rows= M(1,1);
cols= M(1,2);

%ouput file(.gct)
fid = fopen('GENEPATTERN.gct', 'w');
% gct version (always #1.2)
fprintf(fid, '%s\n','#1.2');

%print # of rows and cols
fprintf(fid, '%d\t%d\n',rows,cols);
fprintf(fid, '%s\t','Gene');
fprintf(fid, '%s\t','Description');

%print disease group names
for c=1:cols
__x= class_name(c);
__id= char(x(1,1));
__fprintf(fid, '%s\t',id);
end;

%print geneid's and expression values
for r=1:rows
__% Start new line
__fprintf(fid, '\n');
__%print gene probe id (extracted from cell array- probeid)
__x= probeid(r);
__id= char(x(1,1));
__fprintf(fid, '%s\t',id);
__%print dummy on probe gene description column
__fprintf(fid, '%\t');

__%print the expression values
__for c=1:cols-1
____fprintf(fid, '%6.3f \t' , expressnValues(r:r, c:c));
__end;
end;

output= fid;
fclose(fid);
fclose('all');

Simple is complex! Muhahahaha [evil laugh].... Oh me gosh, its August already!
Click on images to view them in larger version

V-logging Gettysburg College Shuttle Services

2009-07-30T17:26:00.000-07:00

A clip of me and my favorite Gettysburg College shuttle driver singing along to Westlifes' ancient song. Like high school teenagers, we blasted music and talked about how beautiful esta vida is. We did this all the way from Shady Grove Metro station to Gettysburg (~90mins). This driver-pal of mine totally reminds me of Patch Adams. I like peoplez who don't take life too dead-serious. [No voy a decir mucho]

Done !!!! [Eukaryotic Array Scanning]

2009-07-28T16:44:00.000-07:00

With a grin on my face, I can finally say that I am done with collecting data for my summer project on muscular dystrophy. I feel like my learning curve has been increasing exponentially since I started interning in May - the same story applies to the interestingness of the project.

[ previous post: cRNA Synthesis ].... the next and last step was to perform Eukaryotic Array Scanning. I finally got what I have been longing for!!! This part of the data collection was performed in a special room. Stepping in the area I knew I was surrounded with highly-ticketed gadgets. In such moments one has to read and re-read the fine print before executing any steps. Bonkers... am sure breaking one of the machines would cost me as much $$ as my college tuition!

Basically, 5 things were done to the cRNA from the diseased muscle;
1. .. it was labelled with biotin (Vit H!)
2. injected into the Micro-array Chip Array
3. hybridized for 16hrs using a Hybridization GeneChip Oven
4. washed and stained with SAPE (Streptavidin Phycoerythrin) using the Fluidics Station. [SAPE binds to biotin on the hybridized cRNA]
5. The chips were then loaded into the Scanner [took about an hour for the scanner to finish reading 8 cartilages]

<--- Wait times always call for some professional whistling.

Now that all the data has been collected, what that remains is performing the mRNA gene expression profiling. High degree computational tools will be used to discover patterns that might give clues about the biological processes associated with the disease physiological states. Let the computer science begin!!!

Click image to view larger version

Freaking Dell E- series Laptop Keyboard

2009-07-26T09:52:00.000-07:00

Every 2-3 months, the keyboard for my Dell Latitude E5500 machine decides to go bonkers. The [backspace], a, s, d, f and [Enter] keys completely stop working. I figured it's not a software/driver problem cos if I plug in an external keyboard, it works perfectly. I am not confident if its a fault that is unique to my machine only but from the way the Dell support team respond to my inquiries, it seems that they get similar complaints from other customers and that they are very aware of this defect in the E-series Latitude computers.

My laptop is only one year old but so far I have replaced the keyboard 3 times. I am kinda fortunate cos my machine is covered under a 4yr warranty program so the Dell people keep sending me the replacement keyboards for free. In order to install the new hardware I have to do a little bit of some dismantling. I actually enjoy doing it as much as I like upgrading RAM!

Click image to view large version

Today I just replaced the keyboard again. If it misbehaves again I will be returning this PC to the Dell peoples. I am not interested in getting a PhD in the laptop keyboard replacement procedure.

c-RNA Synthesis [Step 2]

2009-07-25T17:09:00.000-07:00

Days are passing-by so quickly. Soon the Childrens Research Institute melody will be over and I will be back in Pennsylvania. Albeit the fact that I am only half way done with my research project, I am satisfied with what I have attained this summer. I have actually gotten more than what I bargained for.

♪The RNA that was previously extracted from muscle tissues from patients with Spinal Muscular Atrophy (SMA) [see RNA extraction post here] was processed for eukaryotic targeting this week. In my project, I will be using gene expression data collected from Affymetrix GeneChip® Arrays [see post] to diagnose an unknown type of muscular dystrophy (UMD). In order to find the ticking gene for the UMD, its gene-phenotype interactions will be compared with those of known Muscular Dystrophy (MD) types (SMA, Becker's MD, Duchene MD, etc).

Click image to view larger version

To synthesize cDNA (complementary DNA), cRNA is used as a template. The first step in this protocol was therefore to synthesize cRNA from the total RNA that we previously extracted from muscle tissue. Total RNA contains ribosomal-RNA's, messenger-RNA's, micro-RNAs, and transfer-RNA. We are only interested in m-RNA (since it contains the information that translates into protein). This is where Prof. Hiraizumi's genetics class starts to make hyper sense!! . mRNA is unique from the rest of the RNA types since it has a Poly-A tail. We therefore used T-7 Oligo(dT) Primers that have complementary poly-T tail to perform the mRNA isolation . In this case, only mRNA strands were transcribed and one strand of cDNA was synthesized.

After cleaning the cDNA, InVitro Transcription Buffer was used to transcribe the cDNA back to cRNA. At this point, we are certain that the cRNA that we have synthesized was pure. So much for the hassle!! After 16 freaking hours of incubation, the cRNA was fragmented to break it down to 35-200 base fragments. This improves the cRNA for microarray probing since an average exon has about 170base pairs (unfragmented mRNA has 800-1500bp on average).

Images from real data (UMD-muscle tissue). Click image to view larger version.
The purity of the c-RNA collected from the diseased muscle tissues was checked using spectrophotometer absorbance values. The quantity of cRNA was also analysed [acceptable value= 20nanogram/microliter]. For my samples, the A260/280 ratio was very close to 2.0 [A260/A280 ratio=1.94 and cRNA quantity= 30.9ng/microL for the sample captured on graph image -LEFT ] (bulls eye!!- am such a professional cRNA extractor). Also, gel electrophoresis had to be run inorder to confirm that the cRNA was completely fragmented. Since fragmented RNA has a short uniform size, it would be expected travel further from the wells and form single bands on the gel. Unfragmented RNA produce numerous strands at different positions. Again, this analysis validated the purity of the cRNA. Pheeew!

Performing ANOVA t-test on Microarray Gene Expression data

2009-07-23T16:31:00.000-07:00

Obama's surprise visit to our research lab at the Childrens Hospital Research Institute didn't shake off my supervisors focus on lab work. On that very afternoon, I got assigned a new task that demanded use of MATLAB® to perform data analysis on microarray data collected from Muscular Dystrophy diseased muscle tissues. I only did it today because I was still healing from the hyper-obama excitement Syndrome. The data that was presented to me was collected using U133plus2 human genome micro array chips which have about 60,000 gene probes. I currently have four data sets with 120 timestamps for each gene probe. This means that the matrices have approximately 60,000 rows and 120 columns.

The task was to remove genes with negligible change in their expression values. To achievetthis , I had to conduct ANOVA (ANalysis Of VAriance) one way t-tests for each gene. Using Microsoft Excel for this undertaking would be like searching for a needle in stacks of hay. With a simple function signGenes - [Significant Genes], that I wrote using MATLAB® programming language , I was able to filter out significant genes from the matrices in less than 30 minutes. More power to MATLAB®!

Click on script image to view larger version

The function works fine- taking about 50 seconds to run through each Microarray matrix. However, M-Lint Code Check keeps giving me the following message:

Line 27: Array 'remove' might be grown using subscripting. Consider preallocating for speed.

I am still a MATLAB novice so this report kinda made me hit the wall. How can I make a cell array for reallocation if I do not know the number of elements that I will be putting in it? I wish this was Java®- I could just make use of Node objects or something!

GeneChip® Human Genome U133Plus 2.0 Array

2009-07-22T17:52:00.000-07:00

So, whats the big deal?

GeneChip® Human Genome U133Plus 2.0 Array (HG-U133 Plus 2.0) is a microarray comprised of 1,300,000 unique oligonucleotide features covering over 47,000 transcripts and variants, which in turn represent 39,000 of the best characterized human genes.

Simply put, microaarays are used for analysing gene expression patterns. Only very few research institutions possess microarray scanners since the technology is very expensive as it is still in its infant stage. One of my main goals for my CRI summer internship is to learn how to prepare RNA for eukaryotic targeting on the GeneChips. There is chance that I might actually get to do the cartridge scanning procedure by myself at the center.

This little braincracker is a manifestation of how important computer technology is to the biological sciences.

Agarose Gel

2009-07-18T18:13:00.000-07:00

Making agarose gel always reminds me of B.O.B, a character from one of my favorite pixar movies (Aliens vs Monsters). Agarose Gel Electrophoresis is a cool application of Physics in the biological sciences. Nucleic Acids (DNA and RNA) are negatively charged due to their phosphate ion composition. When placed in electrolytic current, nucleic acids migrate towards the cathode. This technique is used to check the composition of the nucleic acid since the smaller macromolecules travel further than the larger one (uses the same principal as chromatography). Gosh, I just used some knowledge from general Physics!!! ... this whole liberal arts education does actually benefit at times.

All the DNA and RNA that we use in the lab has to be checked for any contamination using gel electrophoresis. I now expect to make gel almost every afternoon.

Agarose gel is not difficult to make. B.O.B solution= Agarose + Ethidium bromide + TBE buffer (Tris/Borate/EDTA)+ a little bit of microwaving. Ethidium bromide is makes the DNA/RNA visible in UV light because it becomes florescent when intercalated with the nucleic acids. The solution needs to be cooled to room temperature after all the agarose powder dissolves completely.

The mixture is then poured in the electrophoresis apparatus and allowed to polymerize.
Dyed (blue) DNA (or RNA) sample is then loaded to the gel wells and the apparatus is then connected to an electric current. The anode/cathode Physics begins at this point....

After running the apparatus for about 30minutes, the gel is read in UV light. In the CRI lab, we use Syngene GeneGnome chemiluminescent imaging system to visualize the nucleic acid bands on the gel. In this case, the gel electrophoresis was used to analyze fragmented and unfragmented cRNA extracted from Spinal Muscular Atrophy patients.

[Ps. My supervisor for the wet lab bench work has the most lovely King Julian/ Indian accent].

Click on image to view larger version

Welcome to the Geek world

2009-07-17T18:02:00.000-07:00

Thoughts while writing thoughts about thoughts....

Click on image to view larger version

Uniform Resource Locators...

DNA Extraction- Gotta catch em all!

2009-07-15T18:06:00.000-07:00

I find it mind-boggling to imagine how DNA molecules store all the information that is needed to build up 'me' [related post]. A permanent change in DNA sequence leads to gene mutations which might end up compromising ones health. DNA extraction is therefore a core procedure in molecular genetics research. Just last week scientists announced that they have identified genetic factors that may indicate the susceptibility to brain cancer (Glioma). According to the researchers, this discovery will open up avenues for scientists to explore, helping them to better understand how brain cancer develops and ultimately find improved ways to diagnose and treat the disease.

Click on image for larger version.

Despite having mastered RNA extraction, I was still queasy to do perform the DNA isolation protocol. The extraction procedure was ladened with numbers with units in milligrams, minutes, rpm ( rotations per minute), micro-liters and degrees Celsius. I found myself studying the procedure and googling up some of the terms and chemicals that were mentioned in the procedure [...reminds me of Organic Chemistry pre-labbing!!]. Little did I know that DNA extraction was actually more flexible than RNA extraction. This is because DNA is more stable than RNA. Tissue samples had to be kept cold throughout the RNA extraction protocol since RNA is more prone to degradation. With DNA, there was no need for chop-chop during pipette-ing... which is a + especially considering the fact that I am still familiarizing myself with what I call the P-Factor [....P2-P20-P200-P500! ] However, unlike RNA isolation, the DNA extraction protocol takes more than 24hrs to complete. [samples need to be mixed with Protienase K and then incubated overnight in order for the tissue to be completely lysed].

The DNA that we extract from the Muscular Dystrophy (MD) muscle tissues will be used in studies that to identify gene-phenotype patterns that would help establish the mechanism of the disease [MD]. Now that I can confidently perform RNA and DNA extraction procedures, I will start performing some of my primary tasks [...will most probably start performing DNA sequencing and site specific mutagenesis].

Fun Step in the protocol:
Nanodropping the extracted DNA samples. It's fantastic to use the Nanodrop Spectrophotometer and the accompanied genius computer software which plots the sample absorbency curve, generates the A260/280 ratio values and calculates the nucleic acid quantity [in nanograms/microliter]. Without computer technology, Genetics is colorless!

Draggy step in the protocol:
Homogenizing the tissue in cell lysis solution. This step needs a lot of patience... or maybe a lot of Taylor Swift music.

MATLAB® Programming Newbie

2009-07-13T19:03:00.000-07:00

My first MATLAB program. I shall call it meanCalc.

Motivation;
Given 6 [.mat] files packed with data obtained from micro-array chips. Each time series data set containing a massive matrix with approximately 60,000 rows and 200 columns, each row representing a unique gene and each column representing a sample [ dystrophy muscle tissue]. Another smaller matrix was included with each of the 6 data files. This matrix had labels for the replicates for each time point in the main matrix. A different number of replicates were made for each diseased muscle sample.

The task; = simple arithmetic... calculating x̄ !!
Before performing any high degree data analysis on each of the 6 data matrices, the gene expression level replicates had to be averaged. This meant that I either had to pick up my Texas scientific calculator and manually work with 6 x 60,000 x 120 (43,200,000!)+ numbers or come up with plan B. It would probably take me a couple of days to finish the task if I were to use a calculator or maybe hours and hours on MS Excel. Oh crap... I forgot Excel couldn't be used cos the matrices couldn't be preview opened in matlab cos they were too big!
I chose Plan B which implied use of CS 111 [Intro to Computer Science] skills to write a program in Matlab that would do the calculations [for me].

Abstraction:
1. Iterate through the (1Xn) labels matrix- keeping track of the indices for all samples that share a unique id (replicates).
2. Use the indices to extract the expression values from the massive (mXn) matrices.
3. Calculate the means of replicates and write the values to a new matrix file.

Click on image for larger version.
The 'not perfect' program takes less than a minute to produce the results. 3 of my fellow interns will be using this program to do the mean calculations for their Asthma, Vitamin D receptors, and Glucocorticoids data matrices. And who knows? We might be getting more data from the wetlab.

Not exactly the same as my first Java® program (HelloWorld!), but a cool way to experience basic CS in Genomics research.

Riverdale Presbyterian Church, Maryland

2009-07-12T09:56:00.000-07:00

This morning I attended a worship service at the Riverdale Presbyterian Church. The church is only 'a 5 minute walk' away from where I am staying. The congregation was very cordial and welcoming. It didn't take them extra effort to figure out that I was a newbie. During the announcements, they called on visitors and then baaaam.... the mic was passed to me so I introduce myself. Its been a long time since I was last put on the spotlight! Anyways, I really liked the way they diffused warmth and friendliness to me- the guest from Gettysburg Pres.

The sermon was entitled "Its Not About You" and was preached by Rev. Kunt Kent [ a member of the Childrens Hospital ethics committee!!...its a small world indeed]. From the parable of the lost sheep (Luke 15), she talked about how much we loose the purpose of our life and end up chasing the wind; competing and striving against each other for 'better scores'. In the end, we spend our gifts and energy to prove our worthiness rather than sharing Gods generosity. The sermon was well articulated. ' loved it...

___________________________________

Dear God,

It's me again down here... don't wanna sound insincere but I'm lost cos sometimes you're so unclear. What can I do? I'm feeling so far from you.Frustrated- Irritated- Disconnected from it all. The weight of the world has pushed me to the wall. I surrender to you- I'm giving in. Come take me- Save me -I want to start again. I'll open my broken heart 'cause I've reached the end and you are the way to begin.

I've seen a million empty smiles living in denial and I don't wanna live like that when nothing's real. I hate how it is to feel; I'm breaking and aching for something beautiful. All the riches in this world couldn't fill this great big hole It takes something so much more. Only you can take me; you can make me whole.

____________________________________

What's mi-RNA? [ RNA Extraction- [Step 1] ]

2009-07-11T16:46:00.000-07:00

My first 'wet lab' task for the Muscular Dystrophy(MD) project was to extract RNA from frozen muscle tissue samples. Part of the project [unknown muscular dystrophy diagnosis] involves comparison of the unknown disease group with known ones (Duchene-MD, Becker-MD etc) using high degree computational analysis tools.
THE TASK was to extract RNA from Spinal Muscular Atrophy (SMA) tissue samples. SMA is a type of muscular dystrophy that is caused by deletion of the SMN (Survival of Motor Neurons) gene. Deficiency of the SMN protein leads to compromise in muscle contraction functioning.

Maphunziro [lessons of the day]:
1. Ask. Ask. and Ask more...[besides, my name translates as 'Ask' in Chizungu]. The first part of the RNA extraction protocol kept mentioning of 'mi-RNA'. This was my first time to hear of such a type of RNA. I only knew m-RNA, t-RNA, r-RNA and sn-RNA. This was enough reason for me to shoot my first question to my lab supervisor. So apparently, mi-RNA's are simply short nucleotide RNA's that are involved in gene expression. [mi for MICRO!]. Besides, my question ended up being an ice-breaker... before I knew it I had started cracking jokes with my supervisor!

2. In biomedical research, you don't take chances. The RNA extraction procedure involved [two] spectrometer quantification for the purity of the nucleic acids. A Nanodrop ND-1000 Spectrometer was used to first determine the A260/280 ratio of RNA before and after cleanup with ethanol. The sample analysis was done in replicates in each case.[Ouuuch.... i was cool with the ratios cos I learned the stuff in Genetics lab with Dr. Hiraziumi !!]. As if it wasn't enough, the extracted RNA had to be run on a gel electrophoresis apparatus in order to ensure that all the samples had bands at the 12 and 16nt positions.

The RNA extraction protocol took about 6hours to complete. Next week, complementary DNA (cDNA) will be synthesized from the extracted RNA.
Click on photos for larger versions.

University of Malawi- College of Medicine (the ordeal)

2009-07-09T16:52:00.000-07:00

[...an extract from a reflectional piece that I wrote in May 2007]

My educational development had been a smooth progress ever since I enrolled in primary [elementary] school. Both my parents valued education so much that they made every possible effort to even keep me away from my Video game console which was then my appendage. They acquired for me books and learning aids that were not available to most of the students from the schools that I went to. I was blessed.

Throughout secondary school [high school], I was always successful in any of the examinations that I took. I graduated from secondary school in 2003, and the following year I attended a one-year premedical sciences program at the University of Malawi-College of Medicine on a scholarship by Global Fund-National Aids Commission. Upon successful completion of this program, I was accepted into the five-year Bachelor of Medicine and Bachelor of Surgery (MBBS) program. It was home only till November 15th, 2005. A memorable day in my social and academic life endeavors. On this day, my studies were discontinued at the University of Malawi; I did not pass three assessment examinations.

Now, this roadblock helped me pause, evaluate and plan how to approach my future educational goals, which I hope will help me become a person who can make a significant contribution in society. I have learned to notice change and embrace it as part of my life process. At the secondary school [high school] that I went to, what really mattered was perusing the concepts from designated books. One didn't really have to understand the material inorder to excel in the national exams. There were scarcely any discussions amongst the students. College life differed. During orientations, we were advised to ‘make use of one another’. I did not value this or understand why it was important. In the MBBS program, we were introduced to new courses that were more rigorous, abstruse and broad. Am talking Anatomy, Physiology, Biochemistry and Community Health with only one year of basic science prep. My classmates had formed study groups in which they hashed out different subject topics. I was convinced that I would not gain anything from that kind of learning style and therefore made no effort to join in any of the groups. The study groups benefited my friends since they shared views and explanations from different sources. It also improved their presentation skills: an element that lacked in my work especially during the oral one-on-one exam. At this level, I needed to become comfortable with other learning styles. Maybe learn from my peers, and not only from books.

It also became clear to me that academics and social life need to be balanced. Work hard-Play Smart!! [As it is said at Gettysburg College]. Maybe I was too fascinated with gaining good grades and laudatory remarks from my classmates. This made me miss the sense of where I was going and why I was heading in that direction.

In my 2 cents, the goal of learning is to ‘acquire the valuable skills’ that prepare one to contribute to making the world a better place for us and the future gen.[its not just about getting A+'s]. The following year [2006], I swallowed the pill, healed and decided to apply the newly learnt valuable life lesson. I was lucky to be selected into a pioneer cohort of USAP at the US Embassy in Malawi where I consequently experienced the beauty of cooperation coupled with hard work. It amazes me when I look back at the things that I have learned from discussions with my fellow students who are also members of the Malawi US-Embassy education-advising center where I studied frequently. My weakest points were surprisingly someone’s strong ones.

The 14th November 2005 made me understand an adage that I have always known since my childhood: “One head cannot hold the roof”. It is an allegory that refers to the traditional round hut that is popular in my country. On the center, the hut has a pole (referred to as “head” in this adage) that holds the roof from collapsing. However, it cannot hold the roof on its own without the buttress from the surrounding wall. The head represents a person who is fighting towards a goal and the hut’s wall represents the people around him who have the same interests as his. We need to work hand in hand with others as we take the steps towards our life goals. I am thankful for the things that I have learned since leaving the University of Malawi. I am now much better prepared to make the most of my future endeavours where I expect to be challenged by new ideas, to learn new ways of looking at the world, to meet new people and try new things.

The 2 Main Projects

2009-07-07T17:59:00.000-07:00

This week I started working on my principal tasks for the CNMC Genetic Medicine Research summer internship [label: CNMC GenMed]. It is spine chilling and very energizing at the same time.

Project 1 is associated with the disease that I am interested in: Muscular Dystrophy (MD) [see my previous post]. One thing you will surely not miss if you visited the research center at the Childrens hospital is the sincere dedication and focus that the faculty put into MD research. I am more than confident that the CNMC team is on the very frontline in the battle against MD.
This is why I am a little nervous with the project that I am currently undertaking. The work that I am involved in is not child-play demo. Instead, it's serious ground breaking research.

The project involves diagnosis of MD (Muscular Dystrophy) using mRNA expression profiling data. [haha...its kinda hard to spell the deal in layman's language!]. I will be using high dimensional data clustering and classification tools to identify the disease gene-phenotype patterns. The main computational analysis tools for this project will be MATLAB® ( a numeric computing environment) and VISDA® (Visual Statistical Data Analyser, a Java® deploy that I will use to generate heat maps).

It was fairly easy for me to teach myself how to program and analyze data in MATLAB® (just in 2days!). The MATLAB® programming language is similar to two languages that I knew before. It was more like programming using C++ and Python using an environment that resembled E-Macs®. Am not very concerned about VISDA because its just an executable Java program that chews the data.

So, why am I excited? Its all because I am (and will be) using the skills that I learned in class. I am swimming in the world that Computer Science and Biology merge. The experience is satisfying! My thumbs up for the bioinformatics class (BIO 251) that I took last semester with Prof Ivaylo and Dr Steve James. [see previous post]

In my other project, I will be assisting with Affymetrix® research on Asthma (wet lab). Micro arrays!!!! I finally will be getting my hands on those little brain cracking pieces of technology. In addition, I will be performing all the tasks listed [here]. Yikes!!
Click photos for larger versions.

Twitt-mom!

2009-07-04T12:18:00.000-07:00

Click image to enlarge

Zits comics + Rainy day = Heaven!

Kodak Moments- part 2

2009-07-02T17:00:00.000-07:00

Oh well... while eating at a fast food outlet at Prince Georges Mall, I racked my brains as to whether the food I consume in the US is more healthy than that of my motherland, Malawi. Most of the food that I ate back in Malawi was freshly grown from small gardens with very minimal use of chemicals. Because of the exorbitant prices of fertilizer, small-scale subsistence farmers in Malawi are forced to produce using organic manure which is mostly made from chicken droppings and cow dung. As I enjoyed the sliced tomato salad, I debated genetically-modified (GM) food vs organic food. Without any evidence or rationale, I was/am naturally slanted towards use of organic foods. However, the GM food that is served in the dining hall at my college has manifestly made me a bit healthier than I was two years ago. At least I choose to believe so.

GM- tomatoes put on shelves in Kennies Supermarket (Gettysburg, PA) ...after being treated with ethylene to redden them!

While on a trip for the US Embassy Ambassadors Self Help Fund, I met this boy and his brother at one of the villages that we traveled to. After school, he goes on the roadside and sells organic tomatoes gleaned from garden behind his parents house. (Nkhota-kota, MALAWI)

Click here for Kodak Moments- part1
Click photo for larger version.

My Dream Ride - [Adios June '09]

2009-06-30T15:58:00.000-07:00

Every son has got a dreamie. Most select the flamboyant BMW, the elegant Mercedes Benz and the classic Bugatti. Only four wheels and one steering. I choose the sporty, sheer and unadulterated one. The Mitsubishi Lancer Evo X. Not for sissies. Among many things, it comes with a turbo charged MIVEC engine that fires 291 horsepower. Its chock full technology produces chest-flattening acceleration and spleen-rupturing cornering. An ideal synthesis for an aggressive manual transmission fan.

[Exit June: Enter July '09- A new month promising many new experiences.
Ps. X-m, thanks a bunch for sharing the awe-inspiring news. I reckon its already joyful July for you. Congratulations !]

Not just medicine. Childrens medicine.

2009-06-29T19:51:00.001-07:00

The official CNMC new employee general orientation session took place today. The event left me feeling as happy as an elephant in a peanut factory. In retrospect, it has been ages since I last felt this super gleeful. The highlight of the day was talking to some of the new CNMC employees. A spectrum of ages there was; both younger and older than me. Listening to their stories, achievements and ambitions challenged me intellectually.

Despite the fact that I was one of the few temporary employees and possibly the least educated, I still had a strong feeling of belonging. This is home. I was unassailably satisfied of my achievement- "sitting in that room" with a group of professionals that are dedicated to providing great medical care to children internationally. A strong army of medical personnel that is serving as the voice of the most vulnerable, preparing the worlds future leaders in child health, and leading the quest to cure some of childhood's most devastating diseases. If I could recall properly, the last time I felt this way was when I got my acceptance letter from Gettysburg College and shared the joy with my fellow fighters, the USAP students at the Malawi US Embassy. I sincerely pray that one day I will be back in that room at CNMC...this time as a resident trainee!

5 things I didn’t know about DMD

2009-06-27T18:31:00.000-07:00

1. DMD- Duchene Muscular Dystrophy (also known as Pseudo hypertrophic) is the number one genetic killer for young boys.
2. It is caused by the absence of dystrophin, a protein that helps keep the muscles intact.
3. DMD affects all voluntary muscles, and the heart and breathing muscles.
4.Incident rate in developing countries is almost twice that of developed countries. This is because of the absence of genetic counseling in developing countries.
5. The CNMC-GenMed Muscular Dystrophy Research Center[previous post], directed by Dr Hoffman[previous post], is one of the lead global contributors in the research for a treatment for the disease.

Dr Hoffman, A Gettysburg College Alumni, discusses a new development in the search for DMD treatment.

"Knowledge is of no value unless you put it into practice.” Anton Chekhov

~

The Orbiter

2009-06-24T23:34:00.000-07:00

It all started with an innocent trip to McDonald’s that I took with my benepai friend, Dinesh. Two McDoubles had to be consumed to reciprocate spending the whole day learning how to use Active X. After a good 10 minutes disceptation on life and death, we found ourselves recklessly cycling back using a road that we both were not familiar with. Deep into the battlefields we went. I guess we both have an inborn sense of adventure and exploration.
As we cycled past the civil war cannon guns, we spotted a random huge wheel spinning in a far distance.

“No way… not in ol’ Gettysburg!”.

It was an amusement park! At that point my friend Dinesh had already made an irrevocable decision that we go check the place out. The beginning of yet another adventure.

The historical town of Gettysburg had turned into Disneyland. The sports park behind Gettysburg hospital was now a magical glitter city. Everything was perfect; the aroma of cotton candy, the popcorn, the overexcited munchkins, and the beautiful filles that swarmed the place.

Money had to be spent. $30 for three rides. My fave being the Orbiter. Being science freaks, I think we both got attracted to this ride because of the Physics that was going on. Basically, the ride had a number of articulated arms radiating from a central rotating vertical axis. Each arm supporting a cluster of cars which were lifted through 90 degrees into the horizontal position once the ride went spinning. It took 5minutes before the machine was set to roll. This provided a space for me and Dinesh to discuss how unsafe the equipment was.

“What if the lock pops open?” investigated Dinesh.

He went ahead and examined the handle to make sure it was securely locked. He double-checked it. And did it again- once more. We were already freaking out. It only took 30 seconds for the Orbiter to gain enough velocity to throw a truck into outerspace. At this point gravity was defied. I felt intestine-less and my lungs were filled up with air like a hot balloon. All I could see were the lights that looked like thousands of tinted fireflies. All I heard was Dinesh screaming like a little girl. After 3 minutes, we both stepped out of the ride feeling dizzy. I laughed so hard. Dinesh desired to puke.

All in all, It was worth taking the risk. I felt like I had stimulated some form of sense that I had never known of. A sixth sense. “Having fun at an amusement park” has now been crossed off the bucket list.

Hear it in Dineshs' voice

Dr. Wang, my internship supervisor, ....

2009-06-24T09:29:00.000-07:00

.... received her PhD degree in Biomedical Engineering and Master degree in Electrical Engineering from The Catholic University of America. She had her joint post-doctoral training in bioinformatics and systems biology at Dr. Eric Hoffman’s (see post) laboratory at CNMC and Dr. Yue Wang’s laboratory at Department of Electrical Engineering, Virginia Tech.

Dr. Wang has extensive experiences in bioinformatics, biomedical engineering and mathematics, and she has worked on various bioinformatics projects, focusing on statistical data mining and neural network classification on high dimensional microarray data. She is continuing her research on designing and developing computational systems biology approaches to studying molecular mechanistic action of glucocorticoids in dystrophic muscle. This research focuses on modeling molecular networks using proteomic, transcriptional and pharmacokinetics and pharmacodynamics (PK/PD) time series data, and involves advanced statisitcal and computational methods in signal processing, dynamic system control and probabilistic graphical model.
Source CNMC Wellstone Muscular Dystrphy Center.

Carpe diem

2009-06-20T18:25:00.000-07:00

Today I sing. I sing because I am overjoyed because of what the Lord has continually done for me. His perfect love I cant explain. His mercy satisfies me- its all I need! I have failed to find purpose, healing and happiness else where but only in His presence. With Him by my side, I will not despair about tomorrow, for the morrow will be anxious for itself.

So I’ll wait upon You now
With my hands released to You
Where a little faith’s enough
To see mountains lift and move

And I’ll wait upon You now
Dedicated to Your will
To this love that will remain
A love that never fails

Hillsong United. Second Chance- By the Valley 2008
Watch Streaming Video Here

Surely your goodness and unfailing love will pursue me all the days of my life, and I will live in the house of the Lord forever. Psalms 23:6

African Heritage week Gettysburg College, Spring '08

Languages of Malawi

2009-06-18T10:07:00.000-07:00

Conflating the two languages: Chichewa and Tumbuka.

Click for youtube video stream

1 Step Up The Ladder

2009-06-17T18:18:00.000-07:00

I asked for it- now I've got it! For the next two months I will be responsible for performing 6 bio related laboratory routines.

Maintaining primary human cells and permanent eukaryotic cell lines
Transfecting cells with DNA clones
Performing Agarose or poklyacrylamide gel electrophoresis, DNA sequencing and site specific mutagenesis, and polymerase chain reaction (PCR) and reverse transcriptions PCR
Constructing recombinant DNA molecules
Preparing and Cleaving purified plasmid and viral DNAs with restriction enzymes
Analysing productivity of antibodies using Western blots, imunopreciptations, and immunofluorescence and analysing enzymatic activies of transfected or infected cells

Now this is where I sting like a bee.

my internship place

2009-06-17T17:12:00.000-07:00

Childrens National Medical Center,Washington DC.
My handset is turning out to be utile in multiple ways.

FC2009

Kodak Moments - part 1

2009-06-16T19:01:00.001-07:00

Click on photos for larger version.

Roadside Bicycle Repair
Originally uploaded by whiteafrican

Inside-Dorm Bicycle RepairAs demonstrated by a Malawian and "the" Zimbabwean in diaspora.
Location: Gettysburg College, PA USA.

You can take a boy out of the country but you can't take the country out of a boy.

Simple Draw using Java Swing GUI

2009-06-14T01:19:00.001-07:00

There is a collection of program files stored in my college account on the Computer Science server- most of which I wrote in my introductory CS courses. I choose to believe that I have decent noesis on Object Oriented Programming, data structures, hardware organization, and systems software - just to mention a few. At this point I can design and implement algorithm in intermediate Java, C++ and Python languages. So I decided to have some of the archived program files developed with intuitive Graphical User Interface (GUI) and then packaged in a way that would make them distributable to non tech savvy users.

First one to be deployed is a drawing program that I coded in Java from scratch during the fall semester of my sophomore year. The project folder had 15 .java class files (118kB) that were compiled into native code (.class) after I had tweaked the GUI. I then created a manifest file and ran the cmf jar utility in order to add the main class attribute. I now have only one executable .jar file (29kB) from which runs on a click in windows. Click here to try the simple shape drawing program (Fumba Draw version 1.0).

Instructions (Firefox):

Choose Open with Java binary.
Click OK to run the draw program.

Comments are most welcome. Version 1.0 uses the JFrame class. For the next version, I wish to create an HTML embeddable web applet using JApplet. I will be implementing a "Load file" feature on the applet.

MOTIVATION:
Last night as I felt so proud of my Computer Science major. Evan (China), a friend of mine, was driving Stanford (Zimbabwe) to Baltimore International Airport (BWI). Scared of a driving back alone, Evan asked me if to join him on the 2hr road trip. None of us had been to BWI before but we easily navigated our way to and fro. The secret: GIS and GPS (Geographic Information System, Global Positioning System respectively). I was simply impressed by how user-friendly the GPS Navigator in the Honda CRV was. Intuitive GUI allows the layperson to interact with computer devices in order for them to extract, process and transmit relevant and import information from the vast array of data.

Stochastic Photography

2009-06-13T13:01:00.000-07:00

Last year my roommate Anskar (aka mesho) charmed me into doing early morning runs. It has now become an established custom that I cannot discontinue. Nkhani yake? I don't do it to burn fat. Instead what drives me is the "pleasurable pain" feeling. It simply forces me out of my duvet and pumps me up for the day. Well, today I took a random photo on my phone as I was plodding around the Quarry lake in the morning Gettysburg fog.

Quarry Apartments: My home at the G'burg College Campus.

Click photo for larger version.

In Control

2009-06-06T18:17:00.000-07:00

Finally... my favorite day of the week is almost here. I have been looking forward to Sunday! It will probably be the last time for me to congregate with my Gettysburg Pres bros and sisters for the next 3 months.

Yesterday, I got my financial aid award notification for the upcoming semester in the mail. The 5 digit number alone was an ingredient for vexation. Questions and concerns clustered up in my (tiny?) head. After whining inordinately, today I decided to send emails to different administrative personnel booking for appointments as I had done in the past. Just before I had started typing on my email Outlook, I remembered of the epiphany that I had whilst singing one of the hymns* last week. I then recalled that I cannot control or fix every situation in life... Well, the past has intelligibly proved to me that trying to fix this particular one is simply chasing the wind.

There certainly are other more important matters that I need to concentrate on instead of being cumbered with the digit-talk ….again and again. My academic advisor would indisputably agree with that. :) . I will not be taking the growling routine this time. So yeah, this is where I float like butterfly and let God be God. Besides, adversity and blessings are two sides on the same coin. We sometimes choose the side we want to see.

*What a friend we have in Jesus, All our sins and griefs to bear! What a privilege to carry - Everything to God in prayer! Oh, what peace we often forfeit, Oh, what needless pain we bear, All because we do not carry- Everything to God in prayer!

Meet an alumni - Dr Hoffman

2009-06-04T22:00:00.000-07:00

Dr Hoffman, a world-renowned geneticist, is the director of the Childrens National Medical Center- Center of Genetic Medicine Research (CGMR) and a professor of Pediatrics and Biochemistry at George Washington University. This summer, I will be interning at the CGMR where he heads (see previous blog post). It so happens that Dr Hoffman graduated from the Gettysburg College (the school that I currently go to) as a Biology and Music double major in 1982. Some of the biology professors at his time are still instructors at my college today. Dr Hoffman got his PhD in Drosophila Genetics from John Hopkins University (one of my dream schools!) in 1986. Drosophila? Drosophila! Oh my... those insects always remind me of Dr Hiraizum, my Genetics course professor...! Dr Hoffman later did his Post-Doctorate in Pediatrics/Genetics at Harvard Medical School and Childrens Hospital in Boston.

Dr Hoffman is one of the most highly cited scientists today. Among other fields, he conducts research on muscular dystrophy, Amyotrophic Lateral Sclerosis (ALS) and spinal cord trauma. It is inspiring to see someone who was once used to be Orange and Blue (my school colors!) contribute so significantly to the world of biomedical research. This summer I look forward to learning from the masters. And yeah, whosoever said it’s a small world was so right. Fumbani Chibaka

4 days to Sunday

2009-06-03T20:22:00.000-07:00

Click image to enlarge
_______________________________________________________

My home in the US. The Gettysburg Presbyterian Church.
208 Baltimore St

________________________________________________________

After Church... chilling with Abraham Lincoln and "the other dude".
Lincoln Square

Testicular Cancer- Early Detection

2009-06-02T16:37:00.000-07:00

Genetics has allowed medical researchers to be able to flag disease or disorder related anomalies by examining an individuals’ DNA. This has made it possible for early detection and most importantly, prevention of disease. But how are genes linked to disease?

According to the Human Genome Project, there are more than 6,000 genetically linked diseases Among many things, genes determine how rigorously our bodies respond to infection. So, somewhere in Disneyland, mom and dad decide to share copies of their genetic information to make a Bambi. Some of the information might get altered or deleted in the process. At the end of the day, information from the gene (smallest unit of hereditary information) is translated into proteins. It is the proteins that play a major role in the normal functioning of the body. A small change in the amino acid composition of a protein causes a structural or chemical change (e.g. polarity) which might later compromise it’s physiological or biochemical functioning.

My main point: This week a UK based research team announced that they have found genetic factors that raise the risk of testicular cancer in men (of course, men… duh!). Their study uncovered genetic variants on chromosome 5, 6 and 12. Lucky numbers huh? The Institute of Cancer Research reports that testicular cancer, common in men aged 15-44, has the highest cure rates of all cancers. About 5% of the uncured cases are mainly because of metastasis which spreads the cancer to other body organs. Now that the genetic flags for the cancer have been labeled, I am assuming that gene therapy will make testicular cancer almost 100% curable since medical scientists will be able to detect it in its very early stages. Big deal…. Pheew!

Remedy 4 Homesickness?

2009-06-01T10:35:00.000-07:00

You only tend to realize that the upcoming semester is going to be really different when your close buddies start calling you to let you know they are finally leaving the US. So precious are the phone conversions because its the last time their Verizon, Sprint and AT&T phone number will register as an incoming call on my phone for the next 6-8 months. So, its real- I am going to spend the whole of next semester with only a third of my friends being on campus. Most of them are studying abroad at the Lancaster University in England through the Gettysburg College Study Abroad Program. Seriously? Now that Long Harry, my Computer Science (CS) "Viet-Cong" companion will not be around, it looks like there will no longer be any babbling in the dining hall after the CS class sessions. All the same, I hope that the CS professors in England will "upheapify" him. That way we can share our misery and adventures through e-communication. e-quetching!

I am still waiting for my employment contract from CNMC-GenMed to arrive in the mail. In preparation for the internship, I have been reminding myself of the basic stuff that I learned last semester. Today I reviewed the Polymerase Chain Reaction(PCR) lab procedures, DNA Southern Blotting and RNA Northern Blotting protocols. If only I had understood the material this well 5 weeks ago, I would have hyper-aced my bioinfo final exam... :))

Whenever I get homesick, I always look up traditional Malawian music videos on you-tube. I professionally do my 50minute music splash just like the one on TelevisionMalawi. Today I came through this amazing Malawian music video by Ty Grin (aka CheKamuzu).

This guy certainly knows how to blend traditional music and Hip-Hop. Am in love with this music video!

Bioinformatics Research Internship at CNMC- GenMed.

2009-05-31T18:51:00.000-07:00

May ‘09 is now a goner. Pheew… In retrospect, I recognize that the month was plausibly the most action packed in terms of the number of hurdles that I had encountered. The first two weeks of the month were all about bidding farewell to the sophomore slump. Such a maturing experience it was. Nevertheless, lessons were learned and of course, decisions and resolutions made. As for now, what really matters is how I face tomorrow.

Talking of the "near" hereafter, it has ultimately turned out that this summer I will be interning at the Children’s National Medical Center (CNMC) - Center of Genetic Medicine (GenMed) in Washington DC. The CNMC is ranked as one of the best pediatrics hospital in America by the US News and World Report. The Research Unit at the Hospital boosts to have the nation’s best researchers. What else would Fumba ask for?

At the CMMC-GenMed, I will be working for Dr Zuyi Wang in her bioinformatics lab. The interning chance was made possible for me by the Frank and Nancy Parsons Foundation award. I surely look forward to making the most of this prestigious opportunity. Many thanks to Professor Ilinkin and Dr. Steve James, my bioinformatics course instructors, for the in silico and in vitro skills that they passed on; Chris Fahey (Gettysburg College int’l student advisor) for the moral support; Marissa Saints, Tiamo and Prof Esacove for the faith and encouragement; and to the CNMC-GenMed center administrator, Marie Pichaske for walking me through the internship application process. I indisputably couldn’t make it without you all.

DC here I come!

Gossip

2009-05-30T09:29:00.000-07:00

The words of a gossip are as wounds, and they go down into the innermost parts of the belly.
Proverbs 18:8

Physics 111

2009-05-29T18:35:00.000-07:00

Click image to enlarge

KmK (Kuseka mpaka Kukomoka!)... My role Model this one.

Totally reminds me of the two kids who used to sit on the front row in my Physics class. It seems their eyes were set to turn into screen-saver mode after the first 2mins of class!!

Malaria Drug Hope

2009-05-29T11:36:00.000-07:00

In the night mosquito whines, hungry for your blood and mine. There is no greater annoying noise than that of a mosquito buzz. I dearly miss the little pesky helicopters hovering around my head. Malawian mosquitoes are so skilled at their navigation so much that neither a hulk squish punch nor swatters can bring them down. At least once every two months, one of my family members is admitted in hospital because of malaria. It seems that me and my dad are the only ones who are spared from this spell. I tend to wonder if my immune is a result of the sickle cell trait abnormality in my blood. If that is the case then I probably inherited it from the father. Looking at the bigger picture, my family members might have the privilege to access medical care in a timely fashion. But one tends to wonder what would happen if I lived in the rural areas where 70% of the Malawian population lives. What if my family was living in one of the villages in a mud hut- surviving on a dollar in a day- without access to quality medical care? What if my brothers and sisters got the regular pain killer prescribed to them by the medical officers because of the absence of malaria medicament at local village health clinic?

On Friday May 29, the BBC reported that scientist have conducted clinical trials in Cambodia which have shown that the artemesinin family of drugs is becoming less effective (news link). Artemesinin is the most currently celebrated drug that treats multi-drug resistant strains of malaria. When I left Malawi in 2007, Chloroquine and Sulfadoxine-Pyrimethamine (SP) were the drugs used in medical facilities to treat Malaria. These drugs no longer effectively treat the new strains of malaria. I tend to wonder if an average Malawian has had access to this miracle drug, Artemesinin. A question I will forward to my colleagues at the Malawi College of Medicine.

It is sad to know that these new drugs only reach the people that need them most after decades pass. The chances for an average person getting access to medication only increases after the drugs have already been tested to be ineffective. The drug prices lower then because scientists no longer patent the drug making it their own. Science vs. Business. Nevertheless, today the average person in sub-Sahara Africa still survives on the ineffective old drugs. Not the inefficient new ones. Worse still, most people are still being administered pain killers like Aspirin (acetylsalicylic acid) and Panadol (paracetamol ) when they are diagnosed of Malaria. I am more than confident that artemesinin will be considered a miracle drug in the rural Malawi areas because it will make a big difference from the drugs that are currently commonly used. So, why not spend the resources, expertise and time to get the artemesinin delivered to the dying people instead of conducting more and more clinical trials of an already FDA approved drug? Let the people have the miracle drug first, after that we can maybe venture into developing better drugs after.

Manchester United wore the wrong jersey.

2009-05-27T14:03:00.000-07:00

Barcelona displayed top-drawer soccer skills in today's match. After the clean 93mins of Barca-domination, we left the "reds" gasping for air. Rooney and Ronaldo were not spared. Eto'o was first to defy gravity-then Messi sealed the victory with an amazing side-net header. I had so much fun watching the game in the college Junction with three of my fellow international students staying oncampus for the summer. Maybe the reds should stick to their red jersey. We are the UEFA 2009 Champions. Viva Barcelona!

Me Goal Statement

2009-05-27T09:23:00.000-07:00

My USAP Global Student Profile

My life dream is to play a significant role in the development of improved health care systems especially in developing countries. I was born and raised in Malawi where I had firsthand experience with problems associated with falling health systems. After attending a one year premedical sciences program at the University of Malawi – College of Medicine, I acquired a strong passion in community health and the role of drugs and vaccines in the community. I am determined that it is my calling to contribute to the medical field.

As an aspiring medical scientist, I have always been interested in the chemistry of life processes. Currently a Biochemistry and Computer Science double major at the Gettysburg College, I envision my future and see myself designing electrical circuits and computer software for medical instrumentation; designing artificial organs, developing computer models to aid interpret medical tests for better diagnostic decisions, and developing computational simulation techniques to the study of biological systems. I believe that integration of current groundbreaking scientific discoveries with medical sciences and application like novel cancer treatment and drug discoveries is very important. Upon my graduation from the Gettysburg College, I desire to enroll in graduate level life science programs. I am interested in analytical medicinal chemistry, computational and biophysical medicinal chemistry, Pharmacology, Molecular genetics, bioinformatics, biochemical engineering and biochemistry.

The liberal arts education at the Gettysburg College has provided me an environment to relate biology, chemistry, physics, mathematics, and computer science. I have developed an overriding love to these disciplines and I would love to use them to make the world a healthier place.

Bogus Blogger - Street Soccer

2009-05-26T19:55:00.000-07:00

There is e'er a first time for everything. Life is all about stepping forward-out of our comfort zones. Together with two other international students (Zimbabwe, Nigeria) and a domestic student, I played street soccer on Carlisle Street (map). Never had I cerebrated of playing street soccer in the US!

Similarly, I got the idea to start a blog from Stanford, a fellow F-1 (international student) at the Gettysburg College. I never thought I would ever blog!

"A wise man writes down what he thinks, a stupid man forgets what he thinks, a complete idiot punishes himself for what he thinks." Anonymous.

Visitor Feedback Box

2009-05-10T23:00:00.000-07:00